Справка цпмпк: Центральная психолого-медико-педагогическая комиссия г. Москвы

Информация для выпускников с ограниченными возможностями здоровья и инвалидностью

ИНФОРМАЦИЯ ДЛЯ ВЫПУСКНИКОВ С ОГРАНИЧЕННЫМИ ВОЗМОЖНОСТЯМИ ЗДОРОВЬЯ И ИНВАЛИДНОСТЬЮ

В соответствии с пунктом 37 Порядка ГИА-11 и пунктом 34 Порядка ГИА-9 для обучающихся, выпускников прошлых лет с ОВЗ, обучающихся, выпускников прошлых лет детей-инвалидов и инвалидов, а также тех, кто обучался по состоянию здоровья на дому, в образовательных организациях, в том числе санаторно-курортных, в которых проводятся необходимые лечебные, реабилитационные и оздоровительные мероприятия для нуждающихся в длительном лечении, ОИВ, загранучреждения и учредители организуют проведение ГИА в условиях, учитывающих состояние их здоровья, особенности психофизического развития.

Указанные категории обучающихся имеют право пройти обследование и получить заключение ПМПК, подтверждающее статус ребенка с ОВЗ и содержащее:

  • рекомендации по форме проведения итоговой аттестации;
  • особым условиям проведения экзамена;
  • сопровождению и поддержке специалистов при подготовке и сдаче ГИА.


Психолого-медико-педагогическая комиссия уведомляет о необходимости заранее предоставить списки обучающихся 9-х, 11-х классов с целью формирования графика заседаний ПМПК.

Документы для представления ребенка на ПМПК доступны для скачивания:
http://pmckursk.ru/gosudarstvennaya-itogovaya-attestatsiya-dlya-obuchayushchikhsya.html

На всех заседаниях ПМПК желательно присутствие сопровождающего специалиста из образовательной организации, которую посещает ребенок.

Необходимые документы для предоставления особых условий

Обучающиеся, выпускники прошлых лет с ОВЗ при подаче заявления предъявляют копию рекомендаций психолого-медико-

педагогической комиссии (ПМПК).

Обучающиеся, выпускники прошлых лет дети-инвалиды и инвалиды — оригинал или заверенную в установленном порядке копию справки, подтверждающей факт установления инвалидности, выданной федеральным государственным учреждением медико-социальной экспертизы (далее – Справка ФГУ МСЭ).

В заявлении обучающиеся указывают специальные условия, учитывающие состояние их здоровья, особенности психофизического развития.

Форма ГИА

Обучающиеся с ограниченными возможностями здоровья, обучающиеся дети-инвалиды и инвалиды по образовательным программам среднего общего образования могут добровольно выбрать форму ГИА 

(единый государственный экзамен (ЕГЭ) или государственный выпускной экзамен (ГВЭ)).

Результаты ГВЭ, в отличие от результатов ЕГЭ, не учитываются при поступлении в вузы, а засчитываются только как итоги государственной итоговой аттестации. Поступить в вуз обучающиеся, сдававшие ГВЭ, смогут по результатам вступительных испытаний, форму и перечень которых определяются образовательной организацией высшего образования.

Продолжительность ГИА

Продолжительность экзамена для данных лиц увеличивается на 1,5 часа (за исключением ЕГЭ по иностранным языкам (раздел «Говорение»).

Продолжительность ЕГЭ по иностранным языкам (раздел «Говорение») 

увеличивается на 30 минут.

Условия проведения ГИА

Материально-технические условия проведения экзамена обеспечивают возможность беспрепятственного доступа таких обучающихся, выпускников прошлых лет в аудитории, туалетные и иные помещения, а также их пребывания в указанных помещениях (наличие пандусов, поручней, расширенных дверных проемов, лифтов, при отсутствии лифтов аудитория располагается на первом этаже; наличие специальных кресел и других приспособлений). 

При проведении экзамена присутствуют ассистентыоказывающие указанным обучающимся, выпускникам прошлых лет необходимую техническую помощь с учетом их индивидуальных возможностей, помогающие им занять рабочее место, передвигаться, прочитать задание. 

Указанные обучающиеся, выпускники прошлых лет с учетом их индивидуальных возможностей пользуются в процессе сдачи экзамена необходимыми им техническими средствами. 

ГВЭ по всем учебным предметам по их желанию проводится в устной форме. 

Для слабослышащих обучающихся, выпускников прошлых лет аудитории для проведения экзамена оборудуются звукоусиливающей аппаратурой как коллективного, так и индивидуального пользования. 

Для глухих и слабослышащих обучающихся, выпускников прошлых лет при необходимости привлекается ассистент-сурдопереводчик. 

Для слепых обучающихся, выпускников прошлых лет:

  • экзаменационные материалы оформляются рельефно-точечным шрифтом Брайля или в виде электронного документа, доступного с помощью компьютера;
  • письменная экзаменационная работа выполняется рельефно-точечным шрифтом Брайля или на компьютере;
  • предусматривается достаточное количество специальных принадлежностей для оформления ответов рельефно-точечным шрифтом Брайля, компьютер. 


Для слабовидящих обучающихся, выпускников прошлых лет экзаменационные материалы копируются в увеличенном размере, в аудиториях для проведения экзаменов предусматривается наличие увеличительных устройств и индивидуальное равномерное освещение не менее 300 люкс. 

Для обучающихся, выпускников прошлых лет с нарушением опорно-двигательного аппарата письменная экзаменационная работа может выполняться на компьютере со специализированным программным обеспечением. 

Во время проведения экзамена для указанных обучающихся, выпускников прошлых лет организуются питание и перерывы для проведения необходимых лечебных и профилактических мероприятий

Для лиц, имеющих медицинские показания для обучения на дому и соответствующие рекомендации психолого-медико-педагогической комиссии, экзамен организуется на дому. 

Особенности рассмотрения апелляций участников ГИА с ОВЗ

Для рассмотрения апелляций участников ГИА с ОВЗ, детей-инвалидов и инвалидов КК привлекает к своей работе тифлопереводчиков (для рассмотрения апелляций слепых участников ГИА), сурдопереводчиков (для рассмотрения апелляций глухих участников ГИА).

Вместе с участником ГИА с ОВЗ, ребенком — инвалидом, инвалидом на рассмотрении его апелляции помимо родителей (законных представителей) может присутствовать ассистент.

В случае обнаружения КК ошибки в переносе ответов слепых или слабовидящих участников ГИА на бланки ГИА конфликтная комиссия учитывает данные ошибки как технический брак. Экзаменационные работы таких участников ГИА проходят повторную обработку (включая перенос на бланки ГИА стандартного размера) и, при необходимости, повторную проверку экспертами.

Официальные сайты:

9 класс: http://gia.edu.ru/ru/graduates_classes/rights/

11 класс: http://www.ege.edu.ru/ru/classes-11/participant/


Тренировочные сборники для подготовки к ГИА обучающихся с ОВЗ

http://www.fipi.ru/oge-i-gve-9/trensborniki-OVZ

Нормативно-правовые и иные документы, регламентирующие порядок проведения ГИА для лиц с ОВЗ, детей-инвалидов и инвалидов:

ФЕДЕРАЛЬНЫЙ ЗАКОН ОТ 29.12.2012 № 273-ФЗ «ОБ ОБРАЗОВАНИИ В РОССИЙСКОЙ ФЕДЕРАЦИИ»*

*     В соответствии с частью 16 статьи 2 Федерального закона от 29 декабря 2012 г. №273-ФЗ «Об образовании в Российской Федерации» к лицам с ОВЗ относятся лица, имеющие недостатки в физическом и (или) психологическом развитии, подтвержденные психолого-медико-педагогической комиссией (далее – ПМПК) и препятствующие получению образования без создания специальных условий. Так как исчерпывающий перечень заболеваний, при наличии которых обучающиеся, выпускники прошлых лет признаются лицами с ОВЗ, отсутствует, принимать решения по выдаче заключений рекомендуется ПМПК самостоятельно с учетом особых образовательных потребностей обучающихся и индивидуальной ситуации развития, при этом срок обращения в ПМПК может не иметь ключевого значения для принятия решения. Предоставленное родителями (законными представителями) детей заключение комиссии является основанием для создания органами исполнительной власти субъектов Российский Федерации, осуществляющими государственное управление в сфере образования, рекомендованных в заключении условий для обучения и воспитания детей.

Электронное образование Республики Татарстан

Государственное бюджетное учреждение «Республиканский центр психолого-педагогической и медико-социальной помощи «Центральная психолого-медико-педагогическая комиссия»

Должность

Заведующий

Ученая степень

нет

Ученое звание

нет

Повышение квалификации

Предмет:

Русский язык

Тема/проблема повышения квалификации:

Актуальные проблемы и современные подходы к преподаванию русского языка и литературы в условиях реализации ФГОС

Обучающая организация:

Государственное автономное образовательное учреждение дополнительного профессионального образования «Институт развития образования Республики Татарстан»

Профессиональная переподготовка

Направление переподготовки:

Сурдопедагогика

Карьера

Уровень профессионального образования

высшее

Специализация (по диплому):

Сурдопедагог, учитель русского языка и литературы

Квалификация

Первая квалификационная категория

Общий стаж:

26 лет

Педагогический стаж:

26 лет

Стаж в данной должности:

3 года

Награды, звания

Благодарственное письмо Министерства образования и науки РТ, 2017г.
Почетная грамота Управления Образования Исполнительного комитета г.Казани, 2016 год
Благодарственное письмо за подготовку призеров интернет – олимпиады «Родник знаний 2013», Благодарственное письмо за подготовку призеров интернет – олимпиады «Родник знаний 2015»
Почетная грамота от образовательного учреждения ГБСКОУ «Казанская специальная (коррекционная) общеобразовательная школа – интернат I-II вида им. Е.Г. Ласточкиной », 2013 год

Официальный информационный портал государственной итоговой аттестации выпускников 9 и 11 классов в Санкт-Петербурге

Для обучающихся с ограниченными возможностями здоровья, обучающихся детей-инвалидов и инвалидов, продолжительность экзамена увеличивается на 1,5 часа.

Для обучающихся с ОВЗ, детей-инвалидов и инвалидов ГИА проводится в форме государственного выпускного экзамена (далее — ГВЭ) с использованием текстов, тем, заданий, билетов. ГИА по отдельным предметам по их желанию проводится в форме ОГЭ.

При подаче заявления для участия в ГИА:

  • обучающиеся с ОВЗ предъявляют копию рекомендаций центральной психолого-медико-педагогической комиссии (далее — ЦПМПК).
  • обучающиеся — дети-инвалиды и инвалиды предъявляют оригинал или заверенную копию справки, подтверждающей факт установления инвалидности, выданной федеральным государственным учреждением медико-социальной экспертизы
  • обучающиеся — дети-инвалиды и инвалиды, при необходимости дополнительных условий проведения ГИА, также предъявляют копию рекомендаций ЦПМПК
  • обучающиеся по специальным (коррекционным) образовательным программам предъявляют копию рекомендаций территориальной психолого-медико-педагогической комиссии.

Обращаем ваше внимание, что согласно п.55 Порядка проведения ГИА, во время экзамена на рабочем столе участника экзамена при необходимости могут находиться лекарства. Необходимость наличия лекарственных препаратов подтверждается справкой лечащего врача и не требует заключения ЦПМПК

Внимание!

Прием документов и выдача заключений ЦПМПК осуществляется по адресу:Санкт-Петербург, Лиговский проспект, дом 46, лит. А, кабинет 209.

Телефон регистратуры: 8 (812) 314-13-12.

Документы может подать совершеннолетний участник ГИА или родители (законные представители) несовершеннолетнего участника ГИА. Иные лица (родственники, представители образовательных организаций и т.п.) могут действовать только при предъявлении документов, подтверждающих их полномочия по представлению интересов участника ГИА

В ЦПМПК обращаются обучающиеся в образовательных организациях по образовательным программам основного общего образования:

Обучающиеся по специальным (коррекционным) образовательным программам обращаются в территориальные психолого-медико-педагогические комиссии.

Проведение экзамена на дому возможно только при наличии заключения ЦПМПК.

Прохождение участником ГИА обследования в ЦПМПК

Перечень документов.

Информирование участников ГИА / их родителей (законных представителей) о дате, времени, месте и порядке проведения обследования осуществляется ЦПМПК в 5-дневный срок с момента подачи документов. Обследование участников ГИА проводится каждым специалистом ЦПМПК индивидуально или несколькими специалистами одновременно. Состав специалистов ЦПМПК, участвующих в проведении обследования, процедура и продолжительность обследования определяются руководителем ЦПМПК исходя из задач обследования, а также возрастных, психофизических и иных индивидуальных особенностей участников ГИА. При решении ЦПМПК о дополнительном обследовании оно проводится в другой день.

Получение заключения ЦПМПК

Документы и результаты обследования представляются на заседание ЦПМПК. Заседания ЦПМПК проводятся не реже 1 раза в неделю. Присутствие участника ГИА на заседании ЦПМПК является обязательным. Заключение ЦПМПК с рекомендациями оформляется на заседании ЦПМПК. Копия заключения ЦПМПК выдается под подпись.
Участник ГИА предоставляет копию заключения ЦПМПК в образовательную организацию, в которой он обучается, при подаче заявления с указанием выбранных предметов и форм проведения ГИА.

Получение документов, необходимых для получения особых условий прохождения ГИА

ОВЗИнвалидыОбучающиеся на дому
Заключение ЦПМПКСправка, подтверждающая факт установления инвалидностиПодтверждение обучения на дому
ГИА только по обязательным учебным предметам  
+30 минут для итогового собеседования
ГИА в форме ГВЭ
ГВЭ в устной форме
Беспрепятственный доступ участников…
+1,5 часа для экзаменов 
Организация питания и перерывов
При наличии рекомендаций ЦПМПК
Организация ППЭ на дому
Присутствие ассистентов…
Использование на ГИА необходимых для выполнения заданий технических средств
Оборудование аудитории для проведения экзамена звукоусиливающей аппаратурой…
Привлечение при необходимости ассистента-сурдопереводчика…
Оформление экзаменационных материалов рельефно-точечным шрифтом Брайля или в виде электронного документа…
Копирование экзаменационных материалов в день проведения экзамена в аудитории в присутствии членов ГЭК в увеличенном размере …
Выполнение письменной экзаменационной работы на компьютере…

 

 Статус обучающегосяДокумент подтверждающий статусКудаЯвкаЗачемФорма ГИААвтоматически

1.

Обучающийся с ограниченными возможностями здоровья

Коррекция

(есть и/или была)

копия рекомендаций психолого-медико-педагогической комиссии

ТПМПК

обязательно

подтверждение статуса обучающегося с ОВЗ

ОГЭ и/или ГВЭ

В соответствии с Порядком

ППЭ оборудуется с учетом индивидуальных особенностей

продолжительность экзамена увеличивается на 1,5 часа по всем учебным предметам

организуются питание и перерывы для проведения необходимых лечебных и профилактических мероприятий

Иное

копия рекомендации психолого-медико-педагогической комиссии

ЦПМПК

обязательно

установление статуса обучающегося с ОВЗ

ОГЭ и/или ГВЭ

2.

Обучающиеся

дети-инвалиды и инвалиды

оригинал или заверенная в установленном порядке копия справки, подтверждающая факт установления инвалидности, выданная федеральным государственным учреждением медико-социальной экспертизы

ЦПМПК

при необходимости

Определить и прописать дополнительные условия, определенные Порядком

ОГЭ и/или ГВЭ

3.

Кто обучался по состоянию здоровья на дому

Заключение врачебной комиссии (справка ВК), подтверждающеемедицинские показания для обучения на дому и приказ ОО об организации обучения на дому

ЦПМПК

обязательно

Определить и прописать дополнительные условия, определенные Порядком

ОГЭ

Особые условия не предусмотрены

4.

 

кто обучался в образовательных организациях, в том числе санаторно-курортных, в которых проводятся необходимые лечебные, реабилитационные и оздоровительные мероприятия для нуждающихся в длительном лечении

оригинал или заверенная в установленном порядке копия справки, подтверждающая факт пребывания в указанных образовательных организациях

ЦПМПК

обязательно

Определить и прописать дополнительные условия, определенные Порядком

ОГЭ

Психолого-медико-педагогическая комиссия (ПМПК) — МБОУ «Барсовская СОШ № 1»

     ПМПК – это психолого-медико-педагогическая комиссия.

     Цель ПМПК  организация помощи детям и подросткам в возрасте до 18 лет на основе проведения комплексного диагностического обследования и определения специальных условий для получения ими образования и необходимой медицинской помощи.

     Задачами ПМПК являются:

  • своевременное выявление, предупреждение и динамическое наблюдение за детьми с проблемами в развитии;
  • комплексная, всесторонняя, динамическая диагностика отклонений в развитии ребенка и его потенциальных возможностей;
  • определение специальных условий развития, воспитания, обучения детей с проблемами в развитии;
  • содействие и инициирование организации условий развития, обучения и воспитания, адекватных индивидуальным особенностям ребенка;
  • внедрение современных технологий диагностики и коррекционной работы с детьми;
  • формирование банка данных о детях и подростках с проблемами в развитии;
  • своевременное направление детей в лечебно-профилактические, оздоровительные, реабилитационные и другие учреждения при возникновении трудностей диагностики, неэффективности оказываемой помощи;
  • консультирование родителей (законных представителей), педагогических и медицинских работников, непосредственно представляющих интересы ребенка в семье и образовательном учреждении;
  • участие в просветительской деятельности, направленной на повышение психолого-педагогической и медико-социальной культуры населения;
  • содействие процессам интеграции в обществе детей с отклонениями в развитии.

     Обратите внимание, что комиссия:

  • ПМПК не принимает решения о необходимости обучения ребенка на дому  (этот вопрос решается в медицинском учреждении).
  • ПМПК не комплектует группы компенсирующей направленности и классы, реализующие адаптированные основные образовательные программы для детей с ограниченными возможностями здоровья. Данную функцию выполняют специалисты районного отдела образования.

Помните,  ПМПК дает рекомендации, а право выбора рекомендуемой программы остается за родителями.

Алгоритм прохождения ПМПК

     Шаг 1.

     Получить направление на прохождение ПМПК.

     Обследование детей на ПМПК может проводиться по направлению органов здравоохранения, социальной защиты, учреждений образования,  с вашего согласия, а также  по инициативе родителей (законных представителей).

     Шаг 2.

     Осуществить предварительную запись, которая проводится также с согласия родителей. Родители дают согласие на обработку персональных данных.

     Шаг 3.

     Подготовить пакет документов, необходимых для прохождения ПМПК:

  • Паспорт родителя (законного представителя)
  • Свидетельство о рождении ребенка, паспорт по достижении 14 лет
  • Опекунское удостоверение (для опекаемых детей)
  • Выписка из истории развития ребенка от педиатра (Ф-12) или наличие амбулаторной карты ребенка
  • Заключение врача-офтальмолога (окулист)
  • Заключение врача-отоларинголога (лор)
  • Заключение врача-невролога (детям дошкольного возраста)
  • Заключение врача-психиатра (для детей старше 4 лет)
  • Заключение врача-ортопеда (для оформления в группу для детей с нарушениями опорно-двигательного аппарата)
  • Педагогическая характеристика из образовательного учреждения (воспитателя, классного руководителя)
  • Представление психолога, логопеда (при наличии специалистов в образовательном учреждении)
  • Табель успеваемости
  • Последние тетради по русскому языку и математике
  • Рисунки (для дошкольников)
  • Медицинские справки должны быть оформлены на отдельных бланках, обязательно наличие штампа учреждения, выдавшего справку,  личной печати и подписи врача (справки  действительны в течение одного года, справка от психиатра действительна шесть месяцев).

     Шаг 4.

     В назначенный день прийти на комиссию.

     Обследование детей осуществляется только в присутствии родителей (законных представителей), лучше, если это будет мама, поскольку именно она сможет ответить на вопросы специалистов по сбору информации о ходе раннего развития ребёнка, если возникнет такая необходимость, в исключительных случаях – по доверенности.

     Шаг 5.

     Получить выписку из протокола обследования.

     По результатам обследования составляется коллегиальное заключение ПМПК, с учетом мнения каждого специалиста. ПМПК выдает на руки родителям выписку из протокола обследования, в которой прописаны заключение комиссии и рекомендации по дальнейшему обучению ребенка. Выписка является документом, подтверждающим право ребенка на обеспечение оптимальных условий для получения им образования.
     Для оформления в специализированный детский сад выписку предъявляют в департамент образования и молодежной политики администрации Сургутского района.

     Родители школьников передают выписку администрации школы.

     Шаг 6.

     Завершается вся работа беседой с  родителями (законными представителями) ребенка. При необходимости разъясняется родителям (законным представителям)  их возможные дальнейшие действия в интересах ребенка.

     Реализация права ребенка на образование.

     Рекомендации родителям к прохождению ПМПК

     При прохождении обследования на ПМПК ребенок должен быть соматически здоров. Плохое самочувствие может сказаться на результатах обследования.

     В случае болезни ребенка обязательно сообщите об этом и перенесите диагностическое обследование на другой день.

     Создайте у ребенка позитивное отношениек процессу обследования: настройте дошкольника на игровую деятельность, а школьника на общение с педагогами.

 

что это, запись, адреса, документы, заключение

ЦПМПК (центральная психолого-медико-педагогическая комиссия) — обследование, необходимое для выявления детей с психологическими и неврологическими особенностями, дефектами развития. Проверка осуществляется только по письменному заявлению родителей, в случае обнаружения отклонений в поведении ребенка.

Что это

ЦПМПК — это комиссия, состоящая из врачей, дефектологов и педагогов, проводящая проверки детей с возможными отклонениями . Цель обследования — выявить дефекты развития, неврологические и психопатические патологии у школьника, разработать ряд корректирующих мер, позволяющих исправить ситуацию

Центральная психолого-медико-педагогическая комиссия может как направить ребенка в спецшколу, так и разрешить ему обучаться среди сверстников. При этом вердикт врачей носит рекомендательный характер, соблюдать его или нет — решают только родители ученика.

Состав различается в зависимости от ситуации. В нее могут входить педагоги, психологи, дефектологи и врачи с разными профилями.

Проверка ЦПМПК проводится только по заявке родителей на основании направления — обязать опекунов по закону нельзя.

Кто может обратиться

Обратиться в ЦМПК могут родители или законные опекуны школьника с возможными патологиями психического или неврологического развития, а также ребенка с ограниченными возможностями. Прохождение центральной комиссии рекомендовано для школьников 1-4 классов. Именно в этом возрасте начинают проявляться всевозможные заболевания.

ЦПМПК может понадобиться в следующих случаях:

  • Установление статуса обучающегося с ограниченными возможностями. Комиссия выносит вердикт о продолжении обучения или направлении школьника в специнтернат.
  • Создание специальных условий обучения в общеобразовательной школе для ребенка с ограниченными возможностями. Необходимость в использовании особых методов и форм обучения подтверждает только ЦМПК.
  • Организация обучения на дому. Переход на домашнее образование может разрешить только ЦПМПК после ряда соответствующих обследований.
  • Переход на обучение по специально адаптированной программе. Комиссия может заключить, что ученик испытывает трудности в получении образования на общих условиях.
  • Создание особых условий при сдаче ГИА для школьника с ограниченными возможностями.

Как записаться

Прием идет по предварительной электронной записи на сайте мос ру. Для этого нужно зарегистрироваться на сайте и оставить заявку.

Прием ведется по следующим адресам:

  • Москва, Долгоруковская, 5 (вход со стороны Фадеева, 2).
  • Москва, Верхний Михайловский проезд, 9а.
  • Москва, Бехтерева, 19.
  • Зеленоград, 1128.

Справочная

Получить консультацию можно по телефону 8 (499) 322-34-30. Справочный центр работает по такому же расписанию, как и московское отделение ЦПМПК.

Время работы

ЦПМПК работает с понедельника по пятницу, с 9 утра до 7 вечера. В среду короткий день — прием начинается с 2 часов дня.

Стоимость

Консультация центральной комиссии бесплатна для всех граждан Российской Федерации. Организация финансируется с налогов, поэтому дополнительную плату члены ЦПМПК взымать не могут.

Если в ходе обследования родителей ребенка просят заплатить, они имеют право оставить жалобу на горячей линии Минздрава.

Необходимые документы

Для прохождения ЦПМПК необходимо заявление, написанное одним из родителей или законным опекуном.

К заявке нужно приложить следующие документы:

  • Оригинал медицинского заключения, полученного в государственной больнице.
  • Справка бюро медико-социальной экспертизы и разработанная программа реабилитации, если ребенок признан инвалидом.
  • Свидетельство о рождении — оригинал или нотариально заверенная ксерокопия.
  • Паспорт, если обучающийся достиг возраста в 14 лет.
  • Паспорт родителя или опекуна, если обучающийся несовершеннолетний.
  • Ксерокопия предыдущего заключения комиссии, если обследование уже проводилось.
  • Направление на обследование от общеобразовательного учреждения, сотрудников социальной службы.
  • Характеристика ученика из общеобразовательного учреждения.
  • Копии контрольных работ, рисунков, поделок — любых результатов самостоятельного труда ребенка.

Прохождение

Несовершеннолетний должен проходить ЦПМПК в присутствии родителя или законного опекуна. Родители имеют право присутствовать на обследовании, задавать уточняющие вопросы членам комиссии. При этом запрещено помогать ребенку отвечать на вопросы.

Заседание комиссии проходит в одном кабинете, где собираются врачи и педагоги. Они по очереди задают обследуемому вопросы. Специалисты могут сидеть как за одним столом, так и за разными.

Список вопросов зависит от возраста обучающегося и предполагаемых диагнозов. Как правило, комиссия дает следующие задания:

  • Рассказать о себе, своих увлечениях, привычках. Поговорить о родителях, сказать, где они работают, чем занимаются в свободное время. Описать дом, назвать количество комнат, вспомнить клички домашних питомцев.
  • Рассказать об окружающем мире, природе, разнице между ночью и днем. Объяснить различие между понятиями «долгий» и «короткий», «темно» и «светло», «больше и меньше».
  • Пройти несколько примитивных заданий на логику. Решить пример а-ля «убрать лишнее», сгруппировать предметы, обобщить какое-либо высказывание.
  • Рассказать о профессиях, частях тела.
  • Пройти тест на память. Запомнить последовательность из нескольких слов, определить, какой предмет убрали со стола.
  • Пройти тест на умение строить предложения, подбирать правильные предлоги и окончания. Объяснить разницу между синонимами и антонимами.
  • Продемонстрировать координацию движений.
  • Рассказать о базовых потребностях — еда, сон, туалет.
  • Нарисовать простой рисунок. Например, «ты когда идешь гулять».

Задания ЦПМПК достаточно простые, и у школьника без патологий развития не должно возникнуть проблем.

Однако ребенок может переволноваться, в результате чего получить неверный вердикт. Поэтому очень важно, чтобы родители правильно подготовили школьника к проверке. Ни в коем случае нельзя нагнетать, кричать на ребенка и утверждать, что от результатов зависит его дальнейшая жизнь.

Взамен лучше успокоить его. Нелишним будет пройти несколько заданий самостоятельно, чтобы подготовить ребенка к дальнейшей проверке в спокойной домашней атмосфере.

При самой комиссии ни в коем случае нельзя давить на школьника, кричать на него, торопить. Дайте ребенку собраться с мыслями, успокойте его, если тот слишком волнуется. Родитель должен защитить ребенка от неправомерных действий комиссии, если психологи и педагоги будут вести себя грубо, нарушать правила профессиональной этики.

Результаты

В результате прохождения ЦПМПК законные представители получают заключение.

В нем может быть рекомендовано одно из следующих решений:

  • Продолжить обучение в общеобразовательной школе.
  • Продолжить обучение в общеобразовательной школе с дополнительными занятиями с психологом, логопедом.
  • Направить ребенка в коррекционную школу.

Вердикт комиссии носит рекомендательный характер. Родители могут как прислушаться ко мнению врачей, так и поступить в соответствии со своими соображениями.

Если комиссия была пройдена некорректно и законные представители не согласны с вердиктом, его можно обжаловать. Для этого нужно обратиться в ПМПК высшего уровня — городскую или областную.

Часто задаваемые вопросы

Часто задаваемые вопросы

ВОПРОС: Какие документы нужны для прохождения ЦПМПК?

Если ребёнку необходимо пройти обследование в ЦПМПК, его родителям / законным  представителям необходимо собрать пакет документов:

  • Свидетельство о рождении / после 14 лет паспорт ребенка (оригинал и ксерокопия) 
  • Паспорт родителя (законного представителя ребенка) сопровождающего ребенка при прохождении комиссии (оригинал и ксерокопия) 
  • В случае отсутствия родителя на комиссии — доверенность лицу, представляющему интересы ребенка на ЦПМПК (доверенность должна быть заверена в установленном законом порядке). Паспорт лица, представляющего ребенка на ЦПМПК, паспорт родителя, написавшего доверенность (ксерокопии)
  • Постановление об установлении опеки (оригинал и ксерокопия) — для опекунов 
  • Справка МСЭ (при наличии) — оригинал и ксерокопия. 
  • Индивидуальная программа реабилитации и абилитации — ИПРА (при наличии) – оригинал и ксерокопия 
  • Выписка из медицинской карты ГБУ РО ОКПНБ (психоневрологический диспансер), если ребенок наблюдается в диспансере 
  • Выписка из медицинской карты поликлиники по месту жительства о развитии и здоровье ребенка с момента рождения по настоящее время (медицинская карта). 
  • Заключение комиссии (ПМПК) о результатах ранее проведенного обследования ребенка (при наличии) – ксерокопия 
  • Подробная педагогическая характеристика, заверенная подписями администрации, классного руководителя, печатью организации, с указанием даты 
  • Рабочие и контрольные тетради по русскому языку, математике. Дневник учащегося 
  • Рисунки и другие результаты самостоятельной продуктивной деятельности ребенка 
  • Направление от организации (школы, ДОУ, организации здравоохранения, социально-реабилитационного центра). В случаях, когда ребенок проходит обследование по инициативе родителей — направление не требуется.
  • Файл для документов, бахилы.
Обследование проводится только при наличии всех необходимых документов, которые предоставляются в ПМПК заранее.

ВОПРОС: Кто входит в состав ПМПК?

Состав ЦПМПК: 

  • Врач-психиатр
  • Педагог-психолог
  • Учитель-дефектолог
  • Учитель-логопед
  • Социальный педагог
  • Сурдопедагог (при необходимости)
  • Врач сурдолог-отолоринголог (при необходимости)
  • Тифлопедагог (при необходимости)

ВОПРОС: Можно ли пройти комиссию без направления от школы?

Обследование детей на ПМПК может проводиться по инициативе и заявлению родителей (законных представителей), либо по направлению образовательной организации, организации, осуществляющей социальное обслуживание, медицинской организации, другой организации (п. 15в Приказа Министерства образования и науки Российской Федерации от 20 сентября 2013 года № 1082 «Об утверждении положения о психолого-медико-педагогической комиссии»).

ВОПРОС: Может ли родитель присутствовать при прохождении комиссии?

Обследование детей осуществляется только в присутствии родителей (законных представителей), желательно присутствие мамы, поскольку именно она сможет ответить на вопросы специалистов о ходе протекания беременности, родов и периоде раннего развития ребёнка. В исключительных случаях (родитель находится в стационаре, длительной командировке), оформляется доверенность установленного образца на ближайшего родственника или сотрудника образовательной организации (например, социального педагога).

ВОПРОС: Что включают в себя специальные условия обучения?

Согласно ст. 79, Федерального закона «Об образовании в Российской Федерации» от 29 декабря 2012 года № 273-ФЗ под специальными условиями для получения образования обучающимися с ограниченными возможностями здоровья в настоящем Федеральном законе понимаются условия обучения, воспитания и развития таких обучающихся, включающие в себя использование специальных образовательных программ и методов обучения и воспитания, специальных учебников, учебных пособий и дидактических материалов, специальных технических средств обучения коллективного и индивидуального пользования, предоставление услуг ассистента (помощника), оказывающего обучающимся необходимую техническую помощь, проведение групповых и индивидуальных коррекционных занятий, обеспечение доступа в здания организаций, осуществляющих образовательную деятельность, и другие условия, без которых невозможно или затруднено освоение образовательных программ обучающимися с ограниченными возможностями здоровья.

ВОПРОС: Каков срок действия заключения ПМПК

Согласно п. 23 Приказа Министерства образования и науки Российской Федерации от 20 сентября 2013 года № 1082 «Об утверждении положения о психолого-медико-педагогической комиссии» заключение комиссии носит для родителей (законных представителей) детей рекомендательный характер. Представленное родителями (законными представителями) детей заключение комиссии является основанием для создания органами исполнительной власти субъектов Российской Федерации, осуществляющими государственное управление в сфере образования, и органами местного самоуправления, осуществляющими управление в сфере образования, образовательными организациями, иными органами и организациями в соответствии с их компетенцией рекомендованных в заключении условий для обучения и воспитания детей.

Заключение комиссии действительно для представления в указанные органы, организации в течение календарного года с даты его подписания.

Таким образом, каждый год проходить ЦПМПК не нужно. Если родители предоставили заключение в образовательное учреждение до истечения года со дня его получения, то оно действительно на всю ступень обучения.

ВОПРОС: Как подготовить ребенка к прохождению комиссии?

При прохождении обследования на ПМПК ребенок должен быть соматически здоров. Плохое самочувствие может сказаться на результатах обследования. Если ребенок заболел, обязательно сообщите о болезни ребенка и отмените Ваш визит на ПМПК в этот день. Создайте у ребенка (школьника) позитивный настрой на обследование, общение с педагогами, врачами. Перед прохождением обследования на ПМПК и во время него сохраняйте спокойствие. Помните, что Ваша тревога может передаваться ребенку. В процессе обследования не подсказывайте ребенку, не отвлекайте его замечаниями и репликами. При необходимости, помощь ребенку окажет специалист, проводящий обследование. При ребенке не произносите фразы «он (она) стесняется», «он (она) не любит учить стихи, рассказывать», «он (она) это не умеет», «он (она) при посторонних людях не отвечает», «он (она) плохо читает», поскольку Вы даете установку на подобное поведение. Внимательно выслушайте рекомендации специалистов по результатам обследования ребенка (запишите важную информацию). Задайте вопросы, уточните то, что непонятно. После обследования похвалите ребенка, даже если он отвечал не совсем так, как  Вы ожидали.

ВОПРОС: Какие категории детей нуждаются в особых условиях при сдаче ГИА?

Согласно Приказам Министерства образования и науки РФ № 1394 от 25.12. 2013 «Об утверждении Порядка проведения государственной итоговой аттестации по образовательным программам основного общего образования», и № 1400 от 26.12. 2013 «Об утверждении Порядка проведения государственной итоговой аттестации по образовательным программам среднего общего образования» обучающиеся с ограниченными возможностями здоровья и обучающиеся дети инвалиды могут проходить государственную итоговую аттестацию в форме государственного выпускного экзамена.

Обучающиеся с ограниченными возможностями здоровья при подаче заявления в ГЭК, представляют копию рекомендаций психолого-медико-педагогической комиссии, а обучающиеся дети-инвалиды и инвалиды — оригинал или заверенную в установленном порядке копию справки, подтверждающий факт установления инвалидности, выданной федеральным государственным учреждением медико-социальной экспертизы.

ВОПРОС: Может ли ПМПК оставить ребёнка на второй год?

В ст.58 п. 8,9 ФЗ «Об образовании в Российской Федерации» указывается: «Обучающиеся в образовательной организации по образовательным программам начального общего, основного общего и среднего общего образования, не ликвидировавшие в установленные сроки академической задолженности с момента ее образования, по усмотрению их родителей (законных представителей) оставляются на повторное обучение, переводятся на обучение по адаптированным образовательным программам в соответствии с рекомендациями психолого-медико-педагогической комиссии либо на обучение по индивидуальному учебному плану».

Таким образом, этот вопрос решается внутри образовательной организации совместно с родителями. Повторное обучение возможно не более одного раза. Если после дублирования программы ученик вновь не аттестован, то он направляется на ПМПК с целью перевода на адаптированную программу с учётом психофизических особенностей ребёнка (например, для детей с ЗПР).

ВОПРОС: Где могут обучаться дети с ОВЗ? Может ли ребёнок с лёгкой умственной отсталостью обучаться в лицее или гимназии?

Согласно ст. 79, Федерального закона «Об образовании в Российской Федерации» от 29 декабря 2012 года № 273-ФЗ образование обучающихся с ограниченными возможностями здоровья может быть организовано как совместно с другими обучающимися, так и в отдельных классах, группах или в отдельных организациях, осуществляющих образовательную деятельность. Ребёнок может обучаться в любой школе по адаптированным программам при условии территориальной отнесённости к этой школе. 

Права и льготы для детей с ограниченными возможностями здоровья

В последние годы активно обсуждаются проблемы социализации инвалидов и лиц с ограниченными возможностями здоровья, а также вопросы предоставления им равных с остальными детьми прав и возможностей в различных сферах жизни.

При этом многие участники дискуссий, считая термин «дети с ОВЗ» толерантным синонимом понятия инвалидности, допускают грубую неточность, обобщая всех детей, имеющих существенные проблемы со здоровьем, в одну категорию – «дети с ограниченными возможностями здоровья».

Такой подход является ошибочным и влечет неверное толкование правовых норм. Рассмотрим, почему.

Пунктом 16 статьи 2 Федерального закона от 29.12.12 № 273-ФЗ «Об образовании в Российской Федерации» (далее – Закон об образовании) установлено следующее: «обучающийся с ограниченными возможностями здоровья – физическое лицо, имеющее недостатки в физическом и (или) психологическом развитии, подтвержденные психолого-медико-педагогической комиссией и препятствующие получению образования без создания специальных условий».

В свою очередь, статья 1 Федерального закона «О социальной защите инвалидов в Российской Федерации» определяет инвалидом лицо, которое имеет нарушение здоровья со стойким расстройством функций организма, обусловленное заболеваниями, последствиями травм или дефектами, приводящее к ограничению жизнедеятельности и вызывающее необходимость его социальной защиты. В зависимости от степени расстройства функций организма лицам, признанным федеральным учреждением медико-социальной экспертизы инвалидами, устанавливается группа инвалидности, а лицам в возрасте до 18 лет устанавливается категория «ребенок-инвалид».

Причина подмены понятий видится в желании смягчить неблагозвучный термин «инвалид», в то время как их разграничение имеет важное юридическое значение.

Статус инвалида (ребенка-инвалида) присваивает бюро медико-социальной экспертизы (далее – бюро МСЭ), а статус ребенка с ОВЗ – психолого-медико-педагогической комиссия (далее – ПМПК). При этом ПМПК принимает решение о выдаче заключения с учетом особых образовательных потребностей обучающихся и индивидуальной ситуации развития.

Таким образом, категория «обучающийся с ОВЗ» определена не с точки зрения ограничений по здоровью, а с позиции создания специальных условий получения образования исходя из решения коллегиального органа – ПМПК.

Важно учитывать, что один и тот же обучающийся может быть и инвалидом, и лицом с ОВЗ. В таком случае у него есть и заключение ПМПК, и ИПРА (индивидуальная программа реабилитации (абилитации)) инвалида, с пометкой о необходимости в образовательной реабилитации.

Соответственно, ребенок-инвалид, не требующий специальных условий для получения образования и не признанный «обучающимся с ОВЗ», получает реабилитационные услуги в иных сферах, например, в здравоохранении или социальной защите, но не в образовании.

В процессе развития общественного сознания представление о лицах с серьезными проблемами здоровья многократно менялось: от примитивных, когда физические дефекты рассматривались как наказание свыше к сегодняшнему времени, когда различия между людьми сглаживаются, и провозглашается всеобщее равенство.

С изменением восприятия менялось и законодательство. Ориентиром для всех прогрессивных государств, ставящих перед собой высокие гуманистические цели, стали нормы международного права, ориентированные на обеспечение равенства прав и возможностей граждан вне зависимости от их состояния здоровья и других факторов. Базовым международным актом, направленным на соблюдение равных прав граждан, стала Всеобщая декларация прав человека от 10 декабря 1948 года, содержащая историческое положение, который гласит: «Все люди рождаются свободными и равными в своем достоинстве и правах».

Современное российское законодательство стремится максимально соответствовать международным стандартам, обеспечивая всем гражданам равные возможности в реализации гражданских, экономических, политических и других прав и свобод. При этом политика государства направлена на то, чтобы социальная защита носила адресный характер и затрагивала все категории граждан, которые в любом обществе признаются социально уязвимыми.

Какими же исключительными правами обладают дети с ОВЗ, и на какие меры социальной поддержки они вправе рассчитывать?

Статьей 43 Конституции Российской Федерации закреплены равное право и одновременно обязанность каждого гражданина на получение основного общего образования. При этом обеспечение образования возлагается на родителей, а государство принимает на себя обязательство поддерживать различные формы образования. Кроме того, статья 39 Конституции гарантирует социальное обеспечение каждому в случаях, установленных законом.

Реализация равного права на образование осуществляется в соответствии с Законом об образовании, предусматривающим создание специальных условий для детей, испытывающих затруднения в учебе, тех самых, которые заключением ПМПК признаны детьми с ОВЗ. Исчерпывающий перечень заболеваний, при наличии которых обучающийся признается с ОВЗ, законодательно не определен, а решение принимается комиссией индивидуально исходя из потребностей в специальных условиях для получения образования.

В соответствии со статьей 79 Закона для таких учащихся создаются специальные коррекционные группы, классы и специальные учреждения, благодаря чему происходит их успешное обучение, воспитание и интеграция в общество. Для них разрабатываются специальные образовательные программы и методы обучения, учебники, пособия и дидактический материал, проводятся индивидуальные и групповые занятия, обеспечивается доступ к зданиям организаций, осуществляющих образовательную деятельность. Обучающиеся с ОВЗ, проживающие в образовательной организации, бесплатно обеспечиваются питанием, одеждой, обувью, мягким и жестким инвентарем. Иные обучающиеся с ОВЗ имеют право на бесплатное двухразовое питание. Обучающимся с ОВЗ предоставляются бесплатно специальные учебники и учебные пособия, иная учебная литература, а также услуги сурдопереводчиков и тифлосурдопереводчиков. Этими же мерами социальной поддержки пользуются и дети-инвалиды. Статьей 39 Закона предусмотрено предоставление обучающимся по образовательным программам среднего профессионального и высшего образования жилых помещений в общежитиях.

К сожалению, длительное время дети с ОВЗ содержались в интернатах, а обучение и воспитание производилось исключительно в условиях специального (коррекционного) образовательного учреждения, что, по мнению ведущих экспертов, вело к углублению неравенства детей с ОВЗ.

В свою очередь, инклюзивный подход, который активно внедряется в современных российских школах способствует максимальному удовлетворению потребностей особенных детей, а их обучение становится более эффективным. Такая практика соответствует общемировой.

Следует отметить, что развитие образования в данном направлении не просто способствует созданию благоприятных условий для детей с проблемами здоровья, но помогает становлению личности маленьких граждан, дает им больше возможностей для саморазвития и получения по окончании школы среднего и высшего профессионального образования. Совместное обучение детей с ОВЗ ставит их на одну ступень со здоровыми сверстниками, что является важным шагом к полноценной, достойной взрослой жизни в обществе и преодолению социального неравенства.

CMPK D3 Оливка для животных

Эта страница содержит информацию о CMPK D3 Drench для ветеринарного применения .
Предоставляемая информация обычно включает следующее:
  • CMPK D3 Индикация промокания
  • Предупреждения и предостережения для CMPK D3 Drench
  • Информация о направлении и дозировке CMPK D3 Drench

CMPK D3 Дренч

Этот режим распространяется на следующие виды:
Компания: Durvet

Пищевая добавка для освежения

ТОЛЬКО ДЛЯ ИСПОЛЬЗОВАНИЯ ЖИВОТНЫХ

ХРАНИТЬ В НЕДОСТУПНОМ ДЛЯ ДЕТЕЙ

ГАРАНТИЙНЫЙ АНАЛИЗ (на корм 354 мл):

Кальций, не менее

14.35%

50 г

Кальций, не более

14,70%

52 г

Фосфор, не менее

0,08%

Калий, не менее

0,25%

Магний, не менее

0.75%

Витамин D 3 , мин

350 000 МЕ

ИНГРЕДИЕНТЫ:

Вода, хлорид кальция, хлорид магния, пропиленгликоль, хлорид калия, гипофосфит натрия и витамин D 3 Добавка.

ПЕРЕД ИСПОЛЬЗОВАНИЕМ ВСТРЯМИТЬ НАСТОЛЬНО

НЕ ДЛЯ ЧЕЛОВЕКА

ПРЕДЛАГАЕМОЕ ИСПОЛЬЗОВАНИЕ:

CMPK D 3 Drench — это пероральная добавка с кальцием, магнием, фосфором, калием и витамином D 3 Добавка для использования до и после освежения молочного и мясного скота для поддержания нормального уровня этих питательных веществ, CMPK D 3 Обливание также рекомендуется для овец и коз.

НАПРАВЛЕНИЯ ПОДАЧИ:

Крупный рогатый скот: Дайте перорально одну 12 унций. перед родами из бутылочки и при необходимости дополнительные кормления после родов.

Овцы и козы: Дайте 1-2 унции. перорально в зависимости от массы тела, до родов и дополнительных кормлений после родов или по указанию ветеринара.

Будьте осторожны при кормлении, чтобы избежать аспирации в легкие.

Не давать животным без глотательного рефлекса.

ЗАЩИТИТЬ ОТ ЗАМЕРЗАНИЯ

ДЕРЖАТЬ В ПРОХЛАДНО-СУХОМ МЕСТЕ

Изготовлено для: DURVET, INC. , Blue Springs, MO 64014

www.durvet.com

СОДЕРЖАНИЕ НЕТТО:

354 мл (12 жидких унций)

LB-DUR220

РЭВ 02-16

CPN: 1084195.3

DURVET, INC.
100 S.E. MAGELLAN DRIVE, BLUE SPRINGS, MO, 64014
Телефон: 816-229-9101
(бесплатно): 800-821-5570
Факс: 816-224-3080
Веб-сайт: www.durvet.com
Электронная почта: [email protected]
Были приложены все усилия для обеспечения точности информации о CMPK D3 Drench, опубликованной выше.Тем не менее, читатели несут ответственность за ознакомление с информацией о продукте, содержащейся на этикетке продукта в США или на вкладыше к упаковке.

Авторские права © 2021 Animalytix LLC. Обновлено: 30.08.2021

C.M.P.K. Гель — VPSI

Achieve Pro Paste с Cryptex

10,99 долл. США

Размер 60 г

Количество

Добавить в корзину


  • Мы больше не можем отправлять товары в Калифорнию.Приносим свои извинения за доставленные неудобства.

Паста для новорожденных из говядины и молочных телят

Achieve Pro с Cryptex эффективно поддерживает телят во время стресса. Он содержит научно разработанную смесь полезных микроорганизмов, питательных веществ, целевых белков и запатентованную матрицу полисахаридов и дрожжевого экстракта, чтобы помочь телятам в периоды стресса, особенно в первые 14 дней жизни, когда телята наиболее уязвимы к болезням.

Поддержка новорожденных телят

К сожалению, не каждый теленок получает необходимое количество качественного молозива в нужное время после рождения. Неблагоприятные условия окружающей среды, такие как грязь, плохая вода, кал, ненастная погода и теснота, могут сделать новорожденных телят уязвимыми в течение первых двух недель жизни. Это может привести к заболеванию теленка.

Pro с преимуществами Cryptex

  1. Высококачественные целевые белки поддерживают здоровье кишечника теленка.
  2. Содержит глицин и полезные бактерии для поддержания оптимального здоровья кишечника.
  3. Обеспечивает пребиотический инулин — фруктоолигосахарид, который, как было доказано, способствует росту полезных бактерий и снижает количество патогенов, таких как кишечная палочка и Clostridium, в кишечнике.
  4. Cryptex — это уникальная запатентованная смесь дрожжевого экстракта и декстрана для поддержания здоровья и целостности кишечника.
  5. Ароматизированный, очень вкусный и легкоусвояемый для телят.
  6. Период вывода не требуется.

Доступна в виде пасты 60 г для удобного применения для новорожденных телят.

Посмотреть полную информацию о продукте

Травяная тетания — распространенная проблема в животноводстве, обычно распространенная в начале весеннего пастбищного сезона, — сказал Дэвид Фернандес, специалист по животноводству в рамках программы Cooperative Extension Program в Университете Аркана.

СОСНОВЫЙ БЛУФ — Травяная тетания — распространенная проблема в животноводстве, обычно распространенная в начале весеннего пастбищного сезона, — сказал Дэвид Фернандес, специалист по животноводству в рамках программы Cooperative Extension Program в Университете Арканзаса в Пайн-Блафф.Овцы и крупный рогатый скот более подвержены этой проблеме, чем козы.

Он предупредил, что зачастую единственным признаком травяной тетании является мертвое животное. Животные с травяной тетанией демонстрируют пошатывающуюся походку, за которой следуют судороги при гребле или плавании, а затем — смерть.

Калий препятствует всасыванию магния в пищеварительном тракте домашнего скота. Быстрорастущие травы, особенно мелкозерновые пастбища, такие как пшеница, рожь и райграс, как правило, содержат много калия. Удобренные калием пастбища также содержат более высокий уровень калия в растениях.По словам Фернандеса, ранняя лактация и поздняя беременность истощают магний и другие минералы, особенно у овец, и предлагает следующие советы по предотвращению травяной тетании.

Ограничьте время, в течение которого животные пасутся на свежем пастбище. Позвольте им наесться досыта сена, прежде чем отправлять их на пастбище. Используйте специальные минеральные блоки с высоким содержанием магния или сыпучий минерал. Дайте скоту магний в течение двух недель, прежде чем выгнать его на свежее пастбище, чтобы уровень магния у него был адекватным на момент выпаса.

Обязательно удалите с пастбища все другие солевые блоки, чтобы домашний скот ел достаточно минерала с высоким содержанием магния.Домашнему скоту не очень нравится вкус минеральной соли магния, поэтому убедитесь, что они едят ее в достаточном количестве ежедневно. Смешайте рассыпчатый минерал магния с патокой или измельченной кукурузой, чтобы облегчить потребление.

Лечите тетанию травы бороглюконатом кальция с содержанием магния от 4 до 5 процентов. Обычно это делается внутривенно,

, так что ваш ветеринар, возможно, назначит его. Кальций-магниевый гель, такой как гель или болюс CMPK, можно вводить перорально, если проблема обнаружена на ранней стадии.

Антацидные таблетки Rolaids

содержат карбонат кальция и гидроксид магния.

«В крайнем случае, растворите около 20 таблеток в четверти стакана воды в виде полива», — сказал Фернандес.

«Будьте осторожны, не подвергайте животное стрессу. Чрезмерное напряжение

может вызвать остановку сердца животного при травяной тетании ».

Для получения дополнительной информации о травяной тетании или других проблемах, связанных с домашним скотом, свяжитесь с Фернандесом по телефону (870) 575-7214 или [email protected] .

UMP / CMPK не является критическим ферментом в метаболизме пиримидин рибонуклеотида и активации аналогов дезоксицитидина в клетках RKO человека

Абстрактные

Фон

Киназа UMP / CMP человека была идентифицирована на основании ее ферментативной активности in vitro .Роль этого белка считается критической для поддержания профиля пула пиримидиновых нуклеотидов и для метаболизма аналогов пиримидина в клетках на основании исследования in vitro частично очищенного фермента и рекомбинантного белка. Однако до сих пор нет подробных исследований, посвященных роли этого белка в метаболизме нуклеотидов в клетках.

Методология / основные выводы

Две стабильные клеточные линии, в которых киназа UMP / CMP (мРНК: AF087865, EC 2.7.4.14) может быть либо повышена, либо понижена, были разработаны с использованием систем экспрессии генов Tet-On.Количество и ферментативная активность киназы UMP / CMP, экстрагированной из этих двух клеточных линий, может быть увеличена на 500% или уменьшена на 95–98%. Рибонуклеотиды эндогенного пиримидина, а также метаболизм экзогенных природных пиримидиновых нуклеозидов и их аналогов не были чувствительны к измененному количеству киназы UMP / CMP в этих двух стабильных клеточных линиях RKO. Уровень включения аналогов пиримидиновых нуклеозидов, таких как гемцитабин (dFdC) и троксацитабин (L-OddC), в клеточную ДНК и их эффективность в ингибировании роста клеток существенно не изменились при повышении или понижении регуляции киназы UMP / CMP. экспрессия в клетках.

Выводы / Значение

Киназа UMP / CMP (EC 2.7.4.14), экспрессируемая в клетках RKO, не является критической для фосфорилирования (d) CMP и поддержания естественных пулов нуклеотидов. Он также не играет важной роли в активации dFdC и L-OddC. Увеличение на 500% или снижение на 95–98% уровней киназы UMP / CMP не влияет на установившиеся уровни dFdC и L-OddC в клетках RKO. В целом, активность и возможные механизмы рекомбинантной киназы UMP / CMP, экспрессируемой в системе in vitro , не могут быть расширены до активности и возможных механизмов киназы UMP / CMP, экспрессированной в системе клеток, или системы in vivo .

Образец цитирования: Hu R, Lam W, Hsu C-H, Cheng Y-C (2011) UMP / CMPK не является критическим ферментом в метаболизме пиримидин рибонуклеотида и активации аналогов дезоксицитидина в RKO-клетках человека. PLoS ONE 6 (5): e19490. https://doi.org/10.1371/journal.pone.0019490

Редактор: Йорг Ланговски, Немецкий центр исследования рака, Германия

Поступила: 11 октября 2010 г .; Одобрена: 7 апреля 2011 г .; Опубликован: 3 мая 2011 г.

Авторские права: © 2011 Hu et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Работа поддержана Национальными институтами здравоохранения [грант CA-63477 и AI-38204]. Y-C.C. является научным сотрудником Национального фонда исследований рака. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

Введение

Ферментативная активность киназы UMP / CMP считается важной для множества биологических процессов, включая синтез РНК, репликацию / репарацию ДНК, синтез мембранных фосфолипидов и метаболизм нуклеотидов в клетках. Киназа UMP / CMP человека (мРНК: AF087865, EC 2.7.4.14) была идентифицирована на основании ее ферментативной активности, катализирующей фосфорилирование CMP, UMP, dCMP и dUMP до их дифосфатных нуклеотидов с использованием частично очищенного белка из клеточного экстракта, а также его рекомбинантный белок [1] ​​- [9].Ген этого белка оказался на хромосоме 1. (1p34.1-p33). Предполагалось, что эта киназа UMP / CMP отвечает за синтез CDP, UDP и dCDP, а также дифосфатов аналога дезоксицитидина / дезоксиуридина [2] — [9]. В исследовании in vitro эффективность этого белка могла зависеть от различных условий ферментативной реакции, таких как концентрация DTT, Mg +2 и ATP и т. Д. . Этим можно объяснить разницу в его свойствах в разных лабораториях.Для рекомбинантного белка его значения Km для CMP, dCMP, UMP и dUMP составляют около 5–500 мкМ, 404–1600 мкМ, 50–1600 мкМ и 1300–5900 мкМ, соответственно; значения Kcat для CMP, dCMP, UMP и dUMP составляют 1,7–248 с –1 , 2,5–216 с –1 , 0,6–140 с –1 и 0,1–7,2 с –1 , соответственно, как показано в Таблице 1 [2], [5], [8], [10]. Физиологические концентрации CMP, dCMP, UMP и dUMP составляют около 34 мкМ, 0,3 мкМ, 184 мкМ и 2,2 мкМ, соответственно, в клетках [11].Кинетические параметры Михаэлиса-Ментен, представленные в таблице 1, однако, демонстрируют гораздо более высокие значения Km этого фермента, чем концентрация его природных субстратов в клетках. Исходя из его ферментативных характеристик, этот фермент будет неэффективен в клетках, если другой связанный (е) белок (ы) не сможет повысить его эффективность. Если количество этого белка изменяется или белок модифицирован, например, повышающая, понижающая регуляция, фосфорилирование, дефосфорилирование, гликозилирование и метилирование, это должно влиять на метаболизм нуклеотидов в клетках.В настоящее время нет подробных исследований, посвященных роли этого белка в метаболизме нуклеотидов в клетках.

Аналоги дезоксицитидина и 5-фторурацил (5-FU) используются в клинике для лечения некоторых опухолей и вирусных инфекций. Эти аналоги дезоксицитидина должны быть ступенчато фосфорилированы до их трифосфатных форм, прежде чем они могут быть включены в клеточную или вирусную ДНК и / или РНК для противоракового и противовирусного действия. Активность киназы UMP / CMP должна иметь решающее значение для цитотоксического действия аналогов цитидина в клетках-мишенях, поскольку она отвечает за фосфорилирование этих монофосфатов аналогов цитидина или монофосфата 5-FU до их дифосфатных метаболитов при противораковой и противовирусной терапии [2], [5 ], [7], [9].Гемцитабин (dFdC) и троксацитабин (L-OddC) являются противораковыми средствами, которые в настоящее время используются или проходят клинические испытания для лечения рака [12]. Хотя конфигурации dFdC и L-OddC различны, первые два этапа их метаболизма, по-видимому, одинаковы. И dFdC, и L-OddC фосфорилируются цитоплазматической дезоксицитидин киназой до их соответствующих монофосфатных метаболитов, а так называемая киназа UMP / CMP in vitro может фосфорилировать монофосфаты dFdC и L-OddC до их дифосфатных метаболитов.Их in vitro значения Km составляют 450–581 мкМ с Vmax 3,6–31 мкмоль / мг / мин и 1037 мкМ с Vmax 0,63 мкмоль / мг / мин соответственно [2], [5]. В метаболизме 5-FU участвует множество ферментов, в которых эта киназа UMP / CMP, как полагают, играет важную роль в активации 5-FU в 5FUTP / 5FdUTP и его включении в РНК и ДНК [12].

Хотя предполагается, что киназа UMP / CMP является ферментом, ответственным за фосфорилирование (d) CMP и (d) UMP, а также некоторых монофосфатов аналогов цитидина, в клетках имеется мало информации, подтверждающей текущую догму.Текущие знания показывают, что база данных метаболических путей KEGG (Киотская энциклопедия генов и геномов) представляет собой сеть взаимодействующих молекул, а также компенсаторные и регуляторные пути во время метаболизма пиримидина в клетках (http://www.genome.jp/kegg/ путь / карта / map00240.html). Однако функционально ген не идентифицируется до тех пор, пока не будет идентифицирована его цель фосфорилирования или пока не будет определена роль в биохимическом пути [13].

В этом исследовании мы пытаемся оценить влияние киназы UMP / CMP, экспрессируемой в клетках, на метаболические и регуляторные пути пиримидина и его аналогов.Были созданы две клеточные линии RKO, в которых экспрессия киназы UMP / CMP может регулироваться доксициклином либо вверх, либо вниз. Внутриклеточный рибонуклеотидный профиль, метаболизм пиримидиновых нуклеозидов, метаболизм dFdC и L-OddC и их цитотоксичность изучались путем изменения количества киназы UMP / CMP в клетках.

Материалы и методы

Химические вещества и клеточная линия

CMP, dCMP, ATP и 5-FU были приобретены у Sigma. [5- 3 H (N)] Cyd, [5- 3 H (N)] dCyd, [5- 3 H] L-OddC, [5- 3 H] dFdC были приобретены у Moravek Biochemicals.Использовали олигонуклеотид двухцепочечной ДНК, кодирующий shРНК киназы UMP / CMP со следующими последовательностями: 5 ′ — (+) CACCCGGGGAAATGGATCAGACAATGGCGAACCATTGTCTGATCCATTTCCC, 5 ′ — (-) Клетки RKO (колоректальной карциномы человека) были подарком лаборатории доктора Эдварда Чу (кафедра внутренней медицины Йельского университета).

Создание стабильной клеточной линии, сверхэкспрессирующей киназу UMP / CMP

Линия индуцибельных клеток киназы Tet-On UMP / CMP была создана с использованием системы экспрессии гена Tet-On (Invitrogen).Были выполнены процедуры, описанные в руководстве пользователя системы экспрессии генов Tet-On. Клетки RKO трансфицировали с помощью регуляторной плазмиды pcDNA6 / TR, которая экспрессировала белок тетрациклинового репрессора (TR). Через 48 часов клетки выращивали в среде с 0,5 мг / мл бластицидина для отбора клеток с экспрессией TR. Отобранные клетки с TR дополнительно трансфицировали с использованием плазмид pcDNA5 / TO с кодирующей последовательностью (мРНК: AF087865) киназы UMP / CMP человека, Tet-чувствительный элемент находится между 5′- BamH I и 3′- Xho. I сайтов вектора pcDNA5 / TO (Invitrogen).Для выделения клеток с котрансфицированными конструкциями через 48 часов трансфекции добавляли селекционную среду с бластицидином и гигромицином в концентрации 0,5 мг / мл. Выбранные клетки были использованы для исследования. Чтобы вызвать экспрессию киназы UMP / CMP, клетки, выращенные в среде, содержащей 5% сыворотки, до 60% слияния, подвергали воздействию доксициклина в различных концентрациях в течение 72 часов. Описанные ниже анализы киназы UMP / CMP использовали для оценки активности киназы UMP / CMP. Данные были проанализированы с помощью программного обеспечения GraphPad.

Создание стабильной клеточной линии, недоэкспрессирующей киназу UMP / CMP

Для дальнейшего изучения функции киназы UMP / CMP в клетках была использована технология RNAi для подавления экспрессии эндогенной киназы UMP / CMP. BLOCK-iT ™ Inducible h2 RNAi Entry Vector, pENTR / h2 / TO, (Invitrogen) был использован для создания стабильной клеточной линии, которая может быть индуцирована для экспрессии короткой шпилечной РНК (shRNA) против киназы UMP / CMP. Двухцепочечный ДНК-олигонуклеотид, генерирующий shРНК киназы UMP / CMP, был клонирован в кассету h2 / TO RNAi, расположенную непосредственно ниже промотора h2 / TO pol III.Этот промотор h2 / TO pol III содержит два сайта TetO 2 для экспрессии, регулируемой тетрациклином. Плазмиду, экспрессирующую shRNA, трансфицировали в клетки RKO с помощью Lipofectamine 2000 (Invitrogen). Для эффективного выделения стабильных клеток с пониженной регуляцией киназы UMP / CMP трансфицированные клетки разводили в соотношении 1-60 в свежей среде в течение 48 часов, а затем добавляли среду для отбора. Все время клетки выращивали в присутствии 0,75 мг / мл зеоцина для отбора. Чтобы вызвать экспрессию shRNA, используемый метод аналогичен описанному выше для сверхэкспрессии киназы UMP / CMP.

Приготовление клеточного экстракта, анализы киназы UMP / CMP, вестерн-блоттинг и иммуноокрашивание

Все клеточные экстракты были получены, как описано [14]. Концентрацию белка в клеточных экстрактах определяли с помощью анализа белка Bio-Rad (Bio-Rad), а оптическую плотность считывали при 595 нм на кинетическом микропланшет-ридере (Molecular Devices Corporation). Ферментные анализы были описаны ранее [10]. В этом исследовании мы использовали оптимальные условия для CMP и dCMP соответственно.Ферментативную реакцию проводили с концентрацией субстратов 1 мМ в буфере, содержащем 50 мМ Трис-HCl, pH 7,5, 10 мМ NaF, 25 мМ NaCl, 2 мМ дитиотреитол (DTT), 0,5 мМ ЭДТА, в котором соотношение АТФ: Mg составляют 2-2 мМ для анализа CMPK и 1-2 мМ для анализа dCMPK. Надосадочную часть клеточных лизатов наносили на 12% SDS-PAGE гели, а затем переносили на чистую нитроцеллюлозную мембрану (Bio-Rad) для анализа вестерн-блоттингом. Затем блот инкубировали со специфическим антителом к ​​UMP / CMP [5], 3-фосфоглицераткиназа (PGK), распознаваемая антителом PGK [15], использовалась в качестве внутреннего контроля.Для иммуноокрашивания белка киназы UMP / CMP в клетках процедуру проводили, как описано ранее [16]. Антитело киназы UMP / CMP и козий антикроличий IgG Alexa Fluor 488 (Invitrogen) использовали для первичного и вторичного окрашивания. Белок HSP27 использовали в качестве контроля в исследованиях совместной локализации с использованием анти-HSP27 (передача сигналов клеток) и козьего антимышиного IgG Alexa Fluor 546 (Invitrogen).

Анализ пула рибонуклеотидов

Профили пула эндогенных нуклеотидов оценивали по увеличению или уменьшению количества киназы UMP / CMP в клетках.Клетки с активированной или подавленной киназой UMP / CMP культивировали в среде, содержащей 10% сыворотки с 0–2,0 нг / мл или 0–10,0 нг / мл доксциклина, соответственно, в течение 72 часов. Клетки собирали и обрабатывали 15% трихлоруксусной кислотой на льду в течение 10 минут после промывания ледяным фосфатно-солевым буфером (PBS), содержащим 20 мкМ дипиридамола (Sigma), для получения экстрактов. Для оценки рибонуклеотидных профилей экстракта клеточного супернатанта, обработанного триоктиламином и 1,1,2-трихлортрифторэтаном, использовали жидкостную хроматографию высокого давления (ВЭЖХ) с колонкой Partisil SAX (Whatman).Нерастворимый в трихлоруксусной кислоте осадок, содержащий нуклеотид, включенный в ДНК, дважды промывали и реолюбилизировали в Me 2 SO перед оценкой на сцинтилляционном счетчике Beckman LS5000TD. Результаты основаны на среднем значении и стандартном отклонении по крайней мере трех независимых экспериментов.

Метаболизм Cyd, dCyd, L-OddC и dFdC в клетках со сверхэкспрессией или недостаточной экспрессией киназы UMP / CMP

Метаболизм радиоактивно меченных Cyd, dCyd и их аналогов был изучен с помощью следующих процедур, которые являются модификацией ранее установленного протокола [16].Вкратце, клетки со сверхэкспрессией и недостаточной экспрессией киназы UMP / CMP высевали из расчета 5 × 10 5 клеток на чашку для культивирования, соответственно. Для сверхэкспрессии к соответствующим клеткам добавляли доксициклин в концентрации 0, 0,4 и 2,0 нг / мл для индукции киназы UMP / CMP; для недостаточной экспрессии к соответствующим клеткам добавляли доксициклин 0, 1,0 и 10 нг / мл для индукции shRNA киназы UMP / CMP с целью подавления киназы UMP / CMP. Через 72 часа, 1 мкМ [5- 3 H] Cyd (2,3 Ки / ммоль), 1 мкМ [5- 3 H] dCyd (2.0 Ки / ммоль), 2 мкМ [5- 3 H] L-OddC (0,4 Ки / ммоль) или 2 мкМ [5- 3 H] dFdC (0,4 Ки / ммоль) добавляли к клеткам, индуцированным доксициклин, соответственно, в указанное время. Параллельные культуры инкубировали с материалами, не содержащими радиоактивной метки, при одинаковых концентрациях для расчета числа клеток. В конце инкубации с радиоактивно меченными материалами клетки собирали для получения неочищенного клеточного экстракта. Затем клеточный супернатант и нерастворимые осадки дополнительно обрабатывали для анализа ВЭЖХ и анализа включения ДНК с помощью процедур, описанных выше.

Анализ ингибирования роста

Эффекты соединений по ингибированию роста оценивали путем измерения ингибирования пролиферации клеток. Экспериментальные процедуры были описаны ранее [17]. Вкратце, клетки RKO с избыточной или недостаточной экспрессией киназы UMP / CMP предварительно обрабатывали доксициклином или без него в различной концентрации в течение 72 часов. Затем 10 4 клеток / мл в фазе логарифмического роста высевали в 24-луночные планшеты и обрабатывали dFdC (0–13 нМ), L-OddC (0–600 нМ) и 5-FU (0–20 мкМ). .После выдерживания культуры в течение 72 часов монослой клеток затем дважды промывали PBS и окрашивали 0,5% метиленовым синим в 50% этаноле. Слой клеток промывали водой, сушили и растворяли в 1% N-лауроилсаркозине (Sigma). Концентрацию белка определяли путем считывания A, , 595, нм на автоматическом считывающем устройстве для микропланшетов (Bio-Tek Instrument, Inc.). Затем определяли эффективность соединений, исследуемых на ингибирование роста клеток, путем сравнения обработанных лунок с необработанными контрольными лунками.

Результаты

Оценка клеток с повышающей и понижающей регуляцией киназных систем UMP / CMP

Чтобы определить, влияет ли киназа UMP / CMP на метаболизм нуклеотидов и фосфорилирование аналогов дезоксицитидина, мы установили две стабильные клеточные линии, в которых киназа UMP / CMP может регулироваться с повышением и с понижением, соответственно. В неиндуцированных условиях уровни белка и ферментативная активность киназы UMP / CMP в клетках с активированной системой сравнимы с таковыми в контрольных клетках.Однако мы наблюдали, что экспрессия белка киназы UMP / CMP снижалась, а активность ферментов снижала конверсию на 93% для CMP и 96% для dCMP в клетках с shRNA-опосредованным нокдауном в неиндуцированных условиях. Это могло быть связано с утечкой промотора h2, о которой сообщали другие [18]. Мы также выяснили, что чем дольше находится в культуре, тем больше утечек. Не было обнаружено изменений количества белка в родительских клетках RKO с / без обработки доксициклином. (Рис. 1Aa).Цифровые изображения клеток продемонстрировали субклеточную локализацию киназы UMP / CMP. Хотя количество фермента не может быть точно измерено методом конфокального микроскопа, экспрессия киназы UMP / CMP явно сверхэкспрессируется в клетках с усиленной системой киназы UMP / CMP после индукции доксициклина. В клетках с пониженной регуляцией киназы UMP / CMP изображения показывают, что экспрессия киназы UMP / CMP достигла базового уровня по сравнению с контрольными клетками (фиг. 1B).

Рисунок 1.Количество белка и ферментативная активность UMP / CMPK в клеточном экстракте из клеток RKO.

Доксициклин вызывает сверхэкспрессию или недостаточную экспрессию киназы UMP / CMP. Специфические антитела к киназе UMP / CMP и PGK использовали для обнаружения белков киназы UMP / CMP и PGK, соответственно, для вестерн-блоттинга. Aa. родительских клеток RKO с индукцией доксициклина или без нее. RKO-CMPK (клетки с усиленной киназной системой UMP / CMP) и RKO-shRNA (клетки с понижающей регуляцией киназной системы UMP / CMP) без индукции доксициклина. Ab. (d) Анализы киназы CMP для родительских клеток RKO, клеток RKO-CMPK и RKO-shRNA без индукции доксициклина. B. изображений конфокальной микроскопии клеток, индуцированных различными концентрациями доксициклина, которые показывают локализацию киназы UMP / CMP (зеленая флуоресценция) и HSP27 (красная флуоресценция). Родительские клетки RKO использовали в качестве контрольных клеток. C. сверхэкспрессия киназы UMP / CMP в клетках RKO. а. экспрессию уровня киназы UMP / CMP определяли вестерн-блоттингом.ПГК используется в качестве внутреннего контроля. г. ферментативная активность киназы UMP / CMP с использованием CMP и dCMP в качестве субстратов. D. недостаточная экспрессия киназы UMP / CMP в клетках RKO. а. экспрессию уровня киназы UMP / CMP определяли вестерн-блоттингом. ПГК используется в качестве внутреннего контроля. г. ферментативная активность киназы UMP / CMP с использованием CMP и dCMP в качестве субстратов.

https://doi.org/10.1371/journal.pone.0019490.g001

Профили пула эндогенных рибонуклеотидов и метаболизм экзогенных Cyd и dCyd не зависят от сверхэкспрессии или недостаточной экспрессии киназы UMP / CMP в клетках

Линии клеток с активированной или подавленной киназной системой UMP / CMP, индуцированной доксициклином, использовали для оценки воздействия киназы UMP / CMP на эндогенные пулы рибонуклеозиддифосфата и трифосфата в клетках. Киназу UMP / CMP, индуцированную доксциклином, контролировали с помощью ферментативного анализа и вестерн-блоттинга.В анализах in vitro , как показано на фиг. 1C, D, наблюдались различные уровни белка и активности киназы UMP / CMP в неиндуцированных клетках (контрольная группа) между обеими клеточными линиями. Ферментативная активность (рис. 1 Cb, Db) и количество (рис. 1 Ca, Da) киназы UMP / CMP в клеточных экстрактах из двух клеточных линий зависят от различных концентраций доксициклина и показывают максимальное изменение около 500% по сравнению с индукцией доксициклина. В клетках с увеличением киназы UMP / CMP на 500% или в клетках с общим снижением на 95–98% i.е. с утечкой 93–96% плюс индуцибельность 2% (рис. 1), нет изменений на профилях пуриновых и пиримидин рибонуклеотидов (рис. 2 Aa, Ba). Метаболизм экзогенных Cyd и dCyd исследовали в этих двух клеточных линиях. На количество дифосфатного или трифосфатного метаболита Cyd или dCyd не влияет изменение количества киназы UMP / CMP в клетках (рис. 2 Ab, Bb). В системе, регулирующей киназу UMP / CMP, уровень монофосфата dCyd в неиндуцированных клетках выше, чем в системе, регулирующей киназу UMP / CMP.Не исключено, что кшРНК неспецифически нацелена на другой белок. Однако после индукции доксициклином не было обнаружено изменений в метаболитах dCyd по сравнению с неиндуцированными клетками. Следовательно, сверхэкспрессия и недостаточная экспрессия киназы UMP / CMP не оказывают большого влияния на включение Cyd и dCyd в РНК или ДНК (рис. 2 Ab, Bb).

Рисунок 2. Оценка профиля пула эндогенных рибонуклеотидов и метаболизма экзогенных Cyd и dCyd в клетках RKO, сверхэкспрессирующих или недоэкспрессирующих киназу UMP / CMP.

Аа. содержание рибонуклеозидди- и трифосфатов в клетках, сверхэкспрессирующих киназу UMP / CMP. Ab. количества метаболитов Cyd и dCyd, а также количества их включения в ДНК (PPT) в клетках, сверхэкспрессирующих киназу UMP / CMP. Ba. содержание рибонуклеозидди- и трифосфатов в клетках, недоэкспрессирующих киназу UMP / CMP. Bb. количества метаболитов Cyd и dCyd, а также количества их включения в ДНК (PPT) в клетках, недоэкспрессирующих киназу UMP / CMP.

https://doi.org/10.1371/journal.pone.0019490.g002

Не влияет на метаболизм dFdC и L-OddC в клетках киназы UMP / CMP с повышенной и пониженной регуляцией

Эффект сверхэкспрессии или недостаточной экспрессии киназы UMP / CMP на метаболизм dFdC и L-OddC исследовали на клетках. Оба набора индуцибельных клеточных линий культивировали в среде с различными концентрациями доксициклина в течение 72 часов, затем обрабатывали 2 мкМ dFdC или 2 мкМ L-OddC, соответственно, в течение 6 часов.В клетках с 500% увеличением или общим 95-98% снижением экспрессии киназы UMP / CMP уровни метаболита dFdC остаются неизменными. Отношения монофосфата dFdC к его дифосфату и трифосфату также аналогичны. Количество dFdC-трифосфата, включенного в ДНК, оставалось постоянным по сравнению с контрольной группой как в клетках, гиперэкспрессирующих, так и недоэкспрессирующих киназу UMP / CMP (рис. 3 A, C). Такие же результаты наблюдаются и для метаболизма L-OddC в обеих индуцибельных клеточных линиях (рис.3 Б, Г).

Рисунок 3. Метаболизм dFdC и L-OddC в клетках, сверхэкспрессирующих или недоэкспрессирующих киназу UMP / CMP.

A. содержание моно-, ди- и трифосфата dFdC в клетках, сверхэкспрессирующих киназу UMP / CMP. B. содержание метаболитов L-OddC в клетках, сверхэкспрессирующих киназу UMP / CMP. C. содержание метаболитов dFdC в клетках, недоэкспрессирующих киназу UMP / CMP. D. содержание метаболитов L-OddC в клетках, недоэкспрессирующих киназу UMP / CMP.

https://doi.org/10.1371/journal.pone.0019490.g003

Сверхэкспрессия и недостаточная экспрессия киназы UMP / CMP не влияют на активность ингибирования роста dFdC, L-OddC и 5-FU в клетках RKO

Целью нашего исследования было оценить эффективность внутриклеточной киназы UMP / MP для облегчения цитотоксической активности dFdC, L-OddC и 5-FU и корреляции трифосфатов с фармакологической активностью этих препаратов. Для клеток с активированной киназой UMP / CMP в присутствии доксициклина различной концентрации (0, 0.4 и 2,0 нг / мл), по сравнению с контрольной группой (доксициклин 0 нг / мл), результаты 72-часового ингибирования роста показали, что дифференциальные эффекты доксициклина, используемого в дозах 0,4 и 2,0 нг / мл, не претерпели значительных изменений во всех случаях. медикаментозное лечение. Двусторонний анализ ANOVA показывает, что их значения P составляют 0,849 и 0,091 для dFdC. Для L-OddC значения P составляют 0,598 и 0,092. Значения P составляют 0,760 и 0,069 для 5-FU. Для клеток с пониженной регуляцией киназы UMP / CMP, индуцированной доксициклином, различные дозировки (2.0, 10,0 нг / мл) доксициклина не оказывали значительного эффекта при лечении всеми лекарственными средствами по сравнению с контрольной группой. Значения P для dFdC составляют 0,919 и 0,652. Значение P для L-OddC составляет 0,391 и 0,392. Значения P 5-FU составляют 0,379 и 0,305. Как показано на фиг. 4, эффективность ингибирования роста клеток не изменяется при изменении количества киназы UMP / CMP в клетках, обработанных лекарственными средствами в течение 72 часов. Результаты согласуются с данными, показанными на рис. 3.

Фигура 4. Активность аналогов дезоксицитидина и 5-FU в отношении ингибирования роста в клетках, повышающая или понижающая экспрессию киназы UMP / CMP.

Аа, Ва, Са. Активность dFdC, L-OddC и 5-FU в отношении ингибирования роста в клетках, повышающая регуляцию киназы UMP / CMP с различной концентрацией доксициклина. Ab, Bb, Cb. Активность dFdC, L-OddC и 5-FU в отношении ингибирования роста в клетках, подавляющая киназу UMP / CMP с различной концентрацией доксициклина.

https://doi.org/10.1371/journal.pone.0019490.g004

Обсуждение

Киназа UMP / CMP человека была идентифицирована на основе ее ферментативной активности in vitro .Большинство исследований киназы UMP / CMP млекопитающих проводилось с частично очищенными ферментами из различных клеток и тканей [2]. КДНК киназы UMP / CMP человека была клонирована, экспрессирована и очищена. Рекомбинантный белок был использован для изучения фосфорилирования как природного (d) CMP, так и их аналогов. Кристаллическая структура в дальнейшем объяснила его кинетические свойства для различных подложек [19]. Его основные биохимические характеристики, основанные на ферментативной активности в системе in vitro , суммированы в таблице 1.Мы создали индуцибельные клеточные линии киназы UMP / CMP в качестве моделей клеток в попытке понять активные пути метаболизма нуклеотидов. Мы сосредоточились на метаболизме эндогенного и экзогенного (d) цитидина, а также на активации их нуклеозидных аналогов в клетках. Наши результаты показали, что уровень киназы UMP / CMP может быть увеличен на 500% или снижен на 95–98%. Однако естественные уровни трифосфата аденозина, гуанозина, уридина и цитидина не изменяются, и метаболизм экзогенного цитидина и дезоксицитидина не изменяется в этих клеточных линиях.Различия в активности ферментов между in vitro в системе и в клеточной системе могут быть связаны с: (1) характеристикой рекомбинантного белка киназы UMP / CMP, экспрессируемого в E. coli , может отличаться от характеристики белка, экспрессируемого в клетках. . В клеточной системе есть основной вклад посттрансляционных модификаций клеток в экспрессируемый белок для эффективной секреции и стабильности. Эти модификации белков включают правильную укладку и агрегацию, окисление метионина, дезамидирование аспарагина и глутамина, вариабельное гликозилирование и протеолиз.Напротив, рекомбинантные белки, экспрессируемые в бактериях, претерпевают простые модификации. [20]. (2) Пути метаболизма нуклеозидов состоят из сложных сетей молекулярного взаимодействия, включающих множество ферментов фосфорилирования / дефосфорилирования, молекулярного связывания и протеолиза, в дополнение к контролю экспрессии генов. На карте метаболических путей KEGG метаболизм (d) CMP в настоящее время состоит из 104 функционально связанных ферментов (дополнительный рисунок S1). В клетках со сверхэкспрессией киназы UMP / CMP регулирование по обратной связи различных ферментов и их продуктов будет уравновешивать влияние киназы UMP / CMP, если она доминирует над превращением (d) CMP в (d) CDP в присутствии доксициклина.В клетках с недоэкспрессированной киназой UMP / CMP вместо этого превращение (d) цитидина могло иметь множество альтернативных путей. Таким образом, результаты продемонстрировали, что эта киназа UMP / CMP, выраженная в изобилии или сниженная до низких уровней, не играет роли в метаболизме пиримидина или поддержании профилей пула пиримидина в клетках RKO. Поскольку клеточные пулы нечувствительны к киназе UMP / CMP, повышающая или понижающая регуляция киназы UMP / CMP может запускать компенсаторные механизмы.Эти результаты показали, что активности и возможные механизмы белка, экспрессируемого в системе in vitro , не могут быть расширены до активности и механизма киназы UMP / CMP, экспрессируемого в клеточной системе, или в системе in vivo .

Наши наблюдения также утверждают, что эта киназа UMP / CMP препятствует фосфорилированию dFdC и L-OddC. Данные цитотоксичности также подтверждают наблюдение за метаболизмом и показывают, что киназа UMP / CMP может не иметь решающего значения для поддержания стабильных уровней dFdC, L-OddC и 5-FU в клетках.Интересно, что анализ выживаемости клеток с использованием образования колоний, описанный Liou et. al. [21] продемонстрировали, что повышающая и понижающая регуляция белка киназы UMP / CMP приводит к изменению клеточной чувствительности к dFdC из-за повышенного образования общего количества дифосфатных и трифосфатных метаболитов в клетках HeLa S3 и HCT-8. . Однако можно предположить, что существует другой компенсаторный путь ступенчатого фосфорилирования этих нуклеозидных аналогов до их трифосфатов. Важно понимать механизм действия многочисленных противоопухолевых и противовирусных аналогов дезоксицитидина, которые должны активироваться до соответствующих трифосфатов.Кроме того, молекулярные изменения также могут иметь потенциал повлиять на выживаемость клеток после лечения аналогами. DFdC в концентрации 100 нМ может эффективно индуцировать экспрессию p53 и Bax , а затем приводить к апоптозу в клетках RKO [22]; Экзонуклеазная активность апуриновой / апиримидиновой эндонуклеазы человека (APE-1) играет важную роль в цитотоксичности L-OddC [23]. Russo P et. al. продемонстрировал, что цитотоксичность 5-ФУ (0,01–10 мкМ) коррелирует со статусом гена p53 и гена Ras в десяти линиях клеток рака толстой кишки человека [24].Опосредованный аналогами нуклеозидов апоптоз, цитотоксичность и развитие клеточного цикла зависят от статуса p53, Ras и уровня APE-1 в клетках. Повышающая или понижающая регуляция киназы UMP / CMP может быть связана с этими путями. Эти наблюдения могут объяснить расхождения между анализом цитотоксичности и выживаемости клеток, в котором клетки подвергались воздействию 5-ФУ (1–100 мкМ), продемонстрированное Humeniuk et. al. [25], [26]. Кроме того, они также предположили, что изменение количества киназы UMP / CMP в клетках может оказать небольшое влияние на чувствительность к 5-FU.

Таким образом, киназа UMP / CMP (EC 2.7.4.14) не является критической для фосфорилирования CMP, dCMP и поддержания пулов природных нуклеотидов в клетках. Он также не играет важной роли в активации dFdC и L-OddC. Увеличение на 500% или снижение на 95–98% его клеточных уровней не влияет на установившиеся уровни dFdC и L-OddC в клетках RKO. Наши настоящие результаты не согласуются с предыдущими справочными отчетами, поскольку мы экспрессировали белок в клеточных системах, а не в in vitro системах .В целом, активность и возможные механизмы рекомбинантной киназы UMP / CMP, экспрессируемой в системах in vitro , нельзя распространить на активность и возможные механизмы киназы UMP / CMP, экспрессируемой в клеточной системе, или системе in vivo .

Благодарности

Мы благодарим доктора Цзе-Юань Лиу и Сьюзан П. Гриль за их внимание и помощь. Мы благодарим Майка Ран Зоу (Mike Ran Zou) (факультет патологии Йельского университета) за критическое прочтение рукописи. Благодарим рецензентов за конструктивные и содержательные комментарии.

Вклад авторов

Задумал и спроектировал эксперименты: RH Y-CC. Проведены эксперименты: RH WL C-HH. Проанализированы данные: RH Y-CC. Предоставленные реагенты / материалы / инструменты анализа: RH. Написал статью: RH Y-CC.

Ссылки

  1. 1. Arima T, Akiyoshi H, Fujii S (1977) Новая дезоксиуридин-5′-трифосфатаза в клетках саркомы Йошида, участвующая в метаболизме дезоксиуридин-5′-трифосфата. Cancer Res 37: 1598–601.
  2. 2. Van Rompay AR, Johansson M, Karlsson A (1999) Фосфорилирование монофосфатов аналогов дезоксицитидина киназой UMP-CMP: молекулярная характеристика человеческого фермента.Mol Pharmacol 56: 562–9.
  3. 3. Hande KR, Chabner BA (1978) Пиримидиннуклеозидмонофосфаткиназа из лейкозных бластных клеток человека. Cancer Res 38: 579–85.
  4. 4. Teng YS, Chen SH, Scott CR (1976) Пиримидиннуклеозидмонофосфаткиназа эритроцитов человека. Частичная очистка и свойства продуктов двух аллельных генов. J Biol Chem 251: 4179–83.
  5. 5. Liou JY, Dutschman GE, Lam W, Jiang Z, Cheng YC (2002) Характеристика киназы UMP / CMP человека и ее фосфорилирование монофосфатов аналога дезоксицитидина D- и L-формы.Cancer Res 62: 1624–31.
  6. 6. Pearman AT, Castro-Faria-Neto HC, McIntyre TM, Prescott SM, Stafforini DM (2001) Характеристика ферментативной активности киназы UMP-CMP человека и 5′-нетранслируемой области. Life Sci 69: 2361–70.
  7. 7. Сегура-Пенья Д., Секулич Н., Орт С., Конрад М., Лави А. (2004) Конформационные изменения, вызванные субстратом в киназе UMP / CMP человека. J Biol Chem 279: 33882–9.
  8. 8. Александр Ж.А., Рой Б., Топалис Д., Поше С., Периго С. и др.(2007) Энантиоселективность киназ AMP, dTMP и UMP-CMP человека. Nucleic Acids Res 35: 4895–904.
  9. 9. Pasti C, Gallois-Montbrun S, Munier-Lehmann H, Veron M, Gilles AM и др. (2003) Реакция киназы UMP-CMP человека с природными и аналоговыми субстратами. Eur J Biochem 270: 1784–90.
  10. 10. Hsu CH, Liou JY, Dutschman GE, Cheng YC (2005) Фосфорилирование цитидина, дезоксицитидина и их аналоговых монофосфатов киназой UMP / CMP человека по-разному регулируется АТФ и магнием.Мол Pharmacol 67: 806–14.
  11. 11. Траут Т.В. (1994) Физиологические концентрации пуринов и пиримидинов. Mol Cell Biochem 140: 1–22.
  12. 12. Чабнер Б., Лонго Д.Л. (2005) Химиотерапия и биотерапия рака: принципы и практика, опубликованные lippincott williams & Wilkins, ISBN 0781756286, 9780781756280.
  13. 13. Bono H, Ogata H, Goto S, Kanehisa M (1998) Реконструкция путей биосинтеза аминокислот из полной последовательности генома.Genome Res 8: 203–210.
  14. 14. Hsu CH, Hu R, Dutschman GE, Yang G, Krishnan P, et al. (2007) Сравнение фосфорилирования 4′-этинил-2 ‘, 3′-дигидро-3’-дезокситимидина с другими аналогами тимидина против вируса иммунодефицита человека. Антимикробные агенты Chemother 51: 1687–93.
  15. 15. Кришнан П., Галлен Е.А., Лам В., Дачман Г.Е., Гриль С.П. и др. (2003) Новая роль 3-фосфоглицераткиназы, гликолитического фермента, в активации аналогов L-нуклеозидов, нового класса противораковых и противовирусных агентов.J Biol Chem 278 (38): 36726–32.
  16. 16. Ху Р., Ли Л., Дегрев Б., Дучман Г. Е., Лам В. и др. (2005) Поведение тимидилаткиназы в отношении монофосфатных метаболитов и ее роль в метаболизме 1- (2′-дезокси-2′-фтор-бета-L-арабинофуранозил) -5-метилурацила (Клевудин) и 2 ‘, 3’- дидегидро-2 ‘, 3’-дидезокситимидин в клетках. Антимикробные агенты Chemother 49: 2044–9.
  17. 17. Dutschman GE, Grill SP, Gullen EA, Haraguchi K, Takeda S и др. (2004) Новый 4′-замещенный аналог ставудина с улучшенной активностью против вируса иммунодефицита человека и пониженной цитотоксичностью.Антимикробные агенты Chemother 48: 1640–6.
  18. 18. Хенриксен Дж. Р., Лёкке С., Хаммерё М., Гертс Д., Верстег Р. и др. (2007) Сравнение эффективности РНКи, опосредованной тетрациклин-чувствительными вариантами промоторов h2 и U6 в линиях клеток млекопитающих. Нуклеиновые кислоты Res 35: e67.
  19. 19. Дарио С.П., Николина С., Орт С., Конрад М., Лави А. (2004) Субстрат-индуцированные конформационные изменения в киназе UMP / CMP человека. J Biol Chem 279: 33882–33889.
  20. 20. Дженкинс Н., Мерфи Л., Тайтер Р. (2008) Посттрансляционные модификации рекомбинантных белков: значение для биофармацевтических препаратов.Мол Биотехнология 39: 113–8. Рассмотрение.
  21. 21. Liou JY, Lai HR, Hsu CH, Chang WL, Hsieh MJ и др. (2010) Модуляция киназы UMP / CMP человека влияет на активацию и клеточную чувствительность аналогов дезоксицитидина. Biochem Pharmacol 79: 381–8.
  22. 22. Chen M, Hough AM, Lawrence TS (2000) Роль p53 в цитотоксичности и радиосенсибилизации, опосредованной гемцитабином. Cancer Chemother Pharmacol 45: 369–74.
  23. 23. Lam W, Park SY, Leung CH, Cheng YC (2006) Уровень белка апуриновой / апиримидиновой эндонуклеазы-1 связан с цитотоксичностью аналогов дезоксицитидина L-конфигурации (троксацитабин и бета-L-2 ‘, 3′-дидезокси-2′ , 3’-дидегидро-5-фторцитидин), но не аналоги дезоксицитидина D-конфигурации (гемцитабин и бета-D-арабинофуранозилцитозин).Mol Pharmacol 69: 1607–14.
  24. 24. Руссо П., Малакарн Д., Фалуги С., Тромбино С., О’Коннор П.М. (2002) RPR-115135. Ингибитор фарнезилтрансферазы усиливает цитотоксичность 5-ФУ- в десяти линиях клеток рака толстой кишки человека: роль р53. Int J Cancer 100: 266–75.
  25. 25. Гуменюк Р., Менон Л.Г., Мишра П.Дж., Горлик Р., Соуэрс Р. и др. (2009) Снижение уровня киназы UMP как механизм устойчивости к фторпиримидину. Mol Cancer Ther 8: 1037–44.
  26. 26. Humeniuk R, Mishra PJ, Bertino JR, Banerjee D (2009) Эпигенетическая реверсия приобретенной устойчивости к лечению 5-фторурацилом.Mol Cancer Ther 8: 1045–54.

Регулярное лечение гипокальциемии — добавочный номер МГУ

Следует ли рассматривать плановое лечение субклинической молочной лихорадки? Чем это отличается от лечения клинической молочной лихорадки?

Если у большого процента ваших коров, вероятно, наблюдается гипокальциемия, следует ли вам регулярно лечить коров? В более ранней статье для расширения возможностей Мичиганского государственного университета «Коровы могут страдать от молочной лихорадки, даже если вы ее не видите», мы представили доказательства того, что, возможно, половина коров второй лактации и более старых коров гипокальциемичны в первые 24 часа после отела и цена этого расстройства для стада высока.Исходя из этого, как лечить от этого коров?

На конференции по молочному питанию 2103 трех штатов Гарретт Эцель из отдела медицинских наук Университета Висконсина сообщил о результатах нескольких исследований влияния различных методов лечения гипокальциемии, включая введение кальция внутривенно, подкожно или перорально. Результаты могут помочь вам разработать более эффективные протоколы лечения вашего стада.

При разработке протокола лечения необходимо принять решение о том, стоит ли корова (субклиническая гипокальциемия и молочная лихорадка I стадии) или корова упала (стадия II или III).Oetzel не рекомендует вводить кальций внутривенно или подкожно для стоящей коровы. Этим коровам на ранней стадии молочной лихорадки он рекомендует только пероральный кальций.

Внутривенное введение

При внутривенном введении 500 миллилитров 23-процентного глюконата кальция происходит быстрое увеличение содержания кальция в крови. В чрезвычайной ситуации это увеличение полезно и необходимо. Поэтому Этцель рекомендует, чтобы любой корове, заболевшей молочной лихорадкой, немедленно давали 500 миллилитров.Однако существует риск внутривенного лечения, поскольку содержание кальция в крови может слишком сильно увеличиться и вызвать сердечный приступ. Кроме того, после первоначального быстрого повышения содержания кальция в крови происходит быстрое снижение, которое снова возвращает корову в гипокальциемическое состояние примерно через 4 часа.

Введение больших доз кальция внутривенно не дает дополнительных преимуществ коровам с молочной лихорадкой и не предотвращает быстрое снижение кальция после введения дозы. Скорее, рекомендация по снижению риска рецидива состоит в том, чтобы давать орально кальций коровам, которые реагируют на внутривенное введение и способны глотать, а затем через 12 часов следует вводить вторую пероральную дозу.

Подкожное введение

При подкожном введении кальция возникает ряд проблем. Для усвоения кальция необходимо обеспечить адекватное кровообращение к периферическим тканям. Периферическое кровообращение может быть нарушено у коров с тяжелой гипокальциемией или обезвоживанием. Кроме того, введенный кальций является едким веществом и может вызвать некроз тканей в месте инъекции. Таким образом, полная доза должна быть разделена на 6-10 мест инъекции, которые находятся на большом расстоянии друг от друга.Растворы кальция, содержащие глюкозу, не следует вводить подкожно, потому что глюкоза таким образом абсорбируется очень плохо и может вызвать абсцесс и отслоение тканей.

Пероральный прием

Пероральный прием кальция имеет то преимущество, что он всасывается из пищеварительного тракта, как кальций из кормовых ингредиентов. Однако производители и сотрудники часто не любят давать кальций внутрь. Гели кальция могут вызвать изъязвление ротовой полости и пищеварительного тракта, вызвать метаболический ацидоз и снизить потребление корма.Давая жидкий раствор кальция, вы рискуете получить аспирацию легких, а растворенный хлорид оказывает сильное едкое воздействие на ткани верхних дыхательных путей. Пропионат кальция менее едкий, но имеет более низкую скорость всасывания и должен вводиться в виде более высокой доли кальция по сравнению с хлоридом кальция, чтобы обеспечить достаточное всасывание кальция.

Oetzel протестировал коммерчески доступный болюс кальция с 43 граммами кальция в виде хлорида кальция и сульфата кальция. Болюс покрыт жиром, состоит из десен и не является ни едким, ни неприятным.Он, по-видимому, быстро распадается после введения и обеспечивает как быстрое высвобождение кальция, так и длительное высвобождение кальция. На этикетке указано, что нужно давать один болюс при отеле, а другой — через 12 часов.

В исследовании со стадами с низким риском молочной лихорадки и, следовательно, маловероятным ответом на добавление кальция, они вводили болюс кальция один раз при отеле и еще раз на следующий день случайно выбранным коровам. Они определили тех коров, у которых была лучшая реакция на пероральный прием кальция.К коровам, которые отреагировали лучше всего, относились около половины всех коров второй и поздней лактации, коров с более высокой надоевой, чем в среднем в предыдущей лактации, и хромых коров. Кроме того, эти коровы дали на 6,8 фунтов больше молока в первый день теста DHI, чем коровы, не получавшие добавки.

Трудность в обеспечении перорального лечения кальцием заключается в том, что мы не можем точно предсказать, какие коровы с наибольшей вероятностью ответят на лечение. Следовательно, мы должны учитывать протоколы для многих свежих коров в стаде по определенным параметрам, таким как более старые коровы или коровы с предыдущими проблемами молочной лихорадки.В стадах, которые не кормят анионными добавками, и / или где обнаруживаются проблемы с коровами переходного периода, добавление ко всем молодым коровам болюсов кальция может быть экономичным.

Экономика

Тестированные пероральные болюсы кальция стоят 6-7 долларов каждый при покупке оптом, в результате чего стоимость одного полного курса лечения составляет 12-14 долларов. На более высоком конце этого диапазона потребовалось бы 70 фунтов молока (по 0,20 доллара за фунт) за период лактации, чтобы оплатить лечение, если бы только надой был единственным преимуществом.Если добавление также снизило частоту смещения сычуга (DA), кетоза и метрита, что привело к улучшению репродуктивной функции, тогда ценность лечения могла бы быть значительно выше.

В целом, если кажется, что новоиспеченные коровы не получают хорошего старта, и если частота переходных проблем на ферме выше, чем должна быть, производители могут рассмотреть возможность попробовать более широкий подход к добавкам и контролировать влияние добавок на молочная продуктивность и заболеваемость первыми коровами.Расширение Мичиганского государственного университета рекомендует производителям работать с ветеринарами своего стада и рассмотреть возможность проверки уровня кальция в сыворотке крови до и после начала лечения. Цель — плавный переход от засушливого периода к раннему периоду лактации.

Другие статьи из этой серии:

Вы нашли эту статью полезной?